微信小陈
微信小章| 产品名称： | Aspergillus brasiliensis Varga et al. |
|---|---|
| 商品货号： | TS210611 |
| Deposited As： | Aspergillus niger van Tieghem |
| Strain Designations： | SN 26 Australian Mycol. Panel series 26, CBS 246.65, DSM 63263, IFO 6342, IMI 91855, NRRL 3536, NRRL A-5243, QM 386 |
| Application： | Bacterial resistance testing adhesives Degrades plastics Fungus resistance testing Fungus resistance testing adhesives Fungus resistance testing airborne equipment Fungus resistance testing automotive components Fungus resistance testing cork Fungus resistance testing electrical insulation Fungus resistance testing leather Fungus resistance testing polymers Fungus resistance testing varnish Fungus resistance testing wax Produces isopullulanase pullulan 4-glucanohydrolase Produces lactoylglutathione glyoxalase I Testing antimicrobial agent Testing wood preservatives |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | no |
| Preceptrol®： | no |
| Comments： | This strain was re-identified asxa0Aspergillus brasiliensisxa0based on multigene sequence analyses. |
| Medium： | ATCC® Medium 336: Potato dextrose agar (PDA) ATCC® Medium 28: Emmons modification of Sabourauds agar ATCC® Medium 200: YM agar or YM broth |
| Growth Conditions： | Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTGTACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTCTGCCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACACGAACCCTGTCTGAAAGCGTGCAGTCTGAGTCGATTGTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCTCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTCCAACCATTCTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA beta-tubulin gene TTTCCCTCCCCGTCCCTCGTCTGTCAGGAGACGCGTCGTTGGTTGGCATCTCTTCTGATCGGGACCCCACCGGTTCTTCGACCAACTCAATCTTGTGCTAACTGCATGTCTTCGTCGCTTCATAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTGCCAACATGTTCTTCGGATGATAGCCCCCAAGGGTTCTTGATTGGTGTTCGGTGGACTAAACAACATATCATGGTGGTTAGGGTAACCAAATTGGTGCTGCTTTCTGGTATGTATCCACTGCCACTGGATTGGGGATGGGACATCATCCATCAGGCTATCTCTCTCAGCTTGAGTTCGGATGATGTCCATTGGGTATATGTTGTCGGTATAACAACACGTCTAACAGTTCAACAGGCAGACCATCTCTGGCGAGCACGGCCTTGACGGCTCCGGTGTGTAAGTGCAACTTTTTTCACACCTCTCAATTGGTCAACAATGGGGAAAGGATTGGGTTTCCTGACGCGCAGGATAGTTACAATGGCACCTCCGACCTCCAGCTGGAGCGCATGAACGTTTACTTCAACCAY |
| Name of Depositor： | WH Weston |
| Isolation： | Wireless radio equipment, New South Wales, Australia |
| Cross References： | Nucleotide (GenBank) : KU897015 beta-tubulin gene Nucleotide (GenBank) : FJ195349 ITS including 5.8S rRNA gene |
| References： | Sakano Y, et al. Pullulan 4-glucanohydrolase from Aspergillus niger. Arch. Biochem. Biophys. 153: 180-187, 1972. PubMed: 4650606 Inoue Y, et al. Metabolism of 2-ketoaldehydes in mold: purification and characterization of glyoxalase I from Aspergillus niger. J. Biochem. 102: 583-589, 1987. PubMed: 3123469 ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01. ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1. ASTM International Standard Practice for Determining Resistance of Synthetic Polymeric Materials to Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method G 0021-96 (Reapproved 2002). RTCA Environmental conditions and test procedures for airborne equipment -- Fungus resistance. Washington, DC:RTCA;RTCA DO-160C. U.S. Department of Defense Insulation, electrical, synthetic-resin composition, nonrigid. Washington, DC:US Department of Defense;Military Specification MIL-I-631D, 1961 U.S. Department of Defense Wax, impregnating, waterproofing, for laminated paper tubes for small arms ammunition. Washington, DC:US Department of Defense;Military Specification MIL-W-10885B, 1956 U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000 Klausmeier RE. Results of the second interlaboratory experiment of biodeterioration of plastics. Int. Biodeterior. Bull. 8: 3-7, 1972. Schmidt E, French DW. Two-day mold testing using a contact agar method. For. Prod. J. 29: 39-42, 1979. Standard Specification for Cellulosic Fiber Loose-Fill Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 0739-05be1. Standard Specification for Self-Supported Spray Applied Cellulosic Thermal Insulation. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1149-06e1. Standard Test Method for Determining Fungi Resistance of Insulation Materials and Facings. West Conshohocken, PA:ASTM International;ASTM Standard Test Method C 1338-00. Standard Test Method for Using Seeded-Agar for the Screening Assessment of Antimicrobial Activity In Carpets. West Conshohocken, PA:ASTM International;ASTM Standard Test Method E 2471-05. Varga J, et al. Aspergillus brasiliensis sp. nov., a biseriate black Aspergillus species with world-wide distribution. Int. J. Syst. Evol. Microbiol. 57: 1925-1932, 2007. Miyazaki T, et al. Heterologous expression and characterization of processing alpha-glucosidase I from Aspergillus brasiliensis TS210611. Glycoconj. J. 28: 563-571, 2011. PubMed: 22020441 Geiser DM, et al. The current status of species recognition and identification in Aspergillus. Stud Mycol 59: 1-10, 2007. PubMed: 18490947 |