微信小陈
微信小章| 产品名称： | Aspergillus flavus Link var. flavus |
|---|---|
| 商品货号： | TS210614 |
| Strain Designations： | WB 1957 CBS 100927, CBS 569.65, IMI 124930, NRRL 1957 |
| Biosafety Level： | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format： | freeze-dried |
| Storage Conditions： | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain： | yes |
| Preceptrol®： | no |
| Medium： | ATCC® Medium 312: Czapeks agar ATCC® Medium 325: Malt extract agar (Blakeslees formula) ATCC® Medium 336: Potato dextrose agar (PDA) |
| Growth Conditions： | Temperature: 24°C toxa026°C
Atmosphere: Typical aerobic |
| Sequenced Data： |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGTAGGGTTCCTAGCGAGCCCAACCTCCCACCCGTGTTTACTGTACCTTAGTTGCTTCGGCGGGCCCGCCATTCATGGCCGCCGGGGGCTCTCAGCCCCGGGCCCGCGCCCGCCGGAGACACCACGAACTCTGTCTGATCTAGTGAAGTCTGAGTTGATTGTATCGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCATCAAGCACGGCTTGTGTGTTGGGTCGTCGTCCCCTCTCCGGGGGGGACGGGCCCCAAAGGCAGCGGCGGCACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGAACGCAAATCAATCTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 28S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGTGCGGCCCCTGTCTAAGTGCCCTGGAACGGGCCGTCAGAGAGGGTGAGAATCCCGTCTGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCTCCAGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCTGGGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCTCCCGGAATGTAGTGCCCTCCGGGGCACCTTATAGCCGGGAGTGCAATGCGGCCAGCCTGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAACGAC |
| Name of Depositor： | KB Raper, DI Fennell |
| Chain of Custody： | ATCC <-- KB Raper, DI Fennell <-- NRRL 1957 <-- Chem. Warfare Serv |
| Isolation： | Cellophane, South Pacific |
| Cross References： | Nucleotide (GenBank) : KU729026 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729110 D1/D2 region of 28S rRNA gene |
| References： | Kozakiewicz Z. Aspergillus species on stored products. Commonw. Mycol. Inst. Mycol. Pap. 161: 1-188, 1989. Gonçalves SS, et al. Aspergillus novoparasiticus: a new clinical species of the section. Flavi. Med. Mycol. 50: 152-160, 2012. PubMed: 21745163 Nakamura H, et al. Evaluation of the aflatoxin biosynthetic genes for identification of the Aspergillus section Flavi. Microbes Environ. 26: 367-369, 2011. PubMed: 21791886 Pildain MB, et al. Two novel aflatoxin-producing Aspergillus species from Argentinean peanuts. Int. J. Syst. Evol. Microbiol. 58: 725-735, 2008. PubMed: 18319485 Peterson SW. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100: 205-226, 2008. PubMed: 18595197 Lee CZ, Liou GY, Yuan GF. Comparison of the aflR gene sequences of strains in Aspergillus section Flavi. Microbiology 152: 161-170, 2006. PubMed: 16385126 Frisvad JC, et al. New ochratoxin A producing species of Aspergillus section Circumdati. Stud. Mycol. 50: 23–43, 2004. Ito Y, et al. Aspergillus pseudotamarii, a new aflatoxin producing species in Aspergillus section Flavi Mycol. Res. 105: 233-239, 2001. Peterson SW, et al. Aspergillus bombycis, a new aflatoxigenic species and genetic variation in its sibling species, A. nomius. Mycologia 93: 689-703, 2001. Henry T, Iwen PC, Hinrichs SH. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. J. Clin. Microbiol. 38: 1510-1515, 2000. PubMed: 10747135 |